Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XE470
Clone ID XE470
Vector pGT1Lxf
Project baygenomics

Sequence tag XE470
Sequence
CCCTCCTCGCTGGCCGCCGTGTCCTCGGATTTATTCCAACAGTCAGTTAAAACATGGTGGATTACTATGAAGTGCTGGGC
GTGCAGAGACATGCCTCACCTGAGGACATTAAAAAGGCGTATCGAAAACAGGCACTTAAATGGCACCCGGACAAAAATCC
TGAAAATAAAGAAGAAGCAGAGCGGAAGTTCAAACAAGTAGCTGAGGCATATGAAGTGTTATCGGATGCTAAAAAGCGGG
ACATCTACGACAAATATGGCAAAGAAGGATTAAATGGTGGTGGAGTAGGAGGTGGAATTCATTTTGACAGTCCATTTGAG
TTTGGCTTCACATTCCGGAACCCAGATGATGTCTTCAGGGTATTTTTTGGTGGAAGGGACCCATTTTCATTTGACTTCTT
T
Sequence Type mRNA
Unitrap ID UNI142

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30062630..30080191 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es