Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST21642
Clone ID OST21642
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST21642
Sequence
AAAGCTTGAAGAGAAGTTTATACAGAGTCCGGAAGATTTGGAAAAGCTAAAAAAAGATGGGAATTTGATGTTTGACCAAG
TGCCCATGGTGGAGATTGATGGGATGAAGCTGGTGCAGACCAGAGCCATTCTCAACTACATCGCCACCAAATATGACCTC
TATGGGAAGGACATGAAGGAGAGAGCCCTGATTGACATGTATTCAGAAGGTATTTTAGATCTGACTGAAATGATTGGGCA
ATTGTTAATATGTCCCCCAGACCAAAAAGAAGCCAAGACTGCCTTGGCAAAAGACAGGACCAAAAACCGTTACTTGCCTG
CCTTTGAAAAGGTGTTGAAGGGCCATGGACAAGACTACCTTGTGGGCNACAGGCTNACCCAGGNNGANCCTTCCNCNTGG
TTGGACCTTTTCCTCTATGTTGAA
Sequence Type mRNA
Unitrap ID UNI28750

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78082889..78152268 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074179 (AC138587.1) NP_001116132 Glutathione S-transferase (EC 2.5.1.18) [Source:UniProtKB/TrEMBL;Acc:Q8K0V9]

 
Come back to gene ENSMUSG00000074179


For any suggestions or comments, please send an email to unitrap@crg.es