Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG816
Clone ID XG816
Vector pGT1Lxf
Project baygenomics

Sequence tag XG816
Sequence
TTTTTTTCTACTTCATTGATCATAATACGAAGACAACCACCTGGTTGGATCCTCGTCTCTGCAAGAAAGCCAAAGCCCCT
TAAGACTGTGAAGATGGAGAGCTTCCCTATGGCTGGGAGAAAATAGAGGACCCTCAGTATGGAGCATACTACGTTGATCG
CGTCGACCATAAAACTCAGTTTGAAAATCCAGTGGAGGAAGCCAAGAGGAAAAAGCAGTTAGGACAGGCTGAAATTCATT
CTGCAAAATCATATGTGTAAAGAGCACACTTTACTCGGGACCCATCCCAACTTAAAGGTGTACTTGTTCGAGCATCGCTG
AAAAAAAGCACCATGGGCTTTGGCTTTACCACTATTGGTGGAGATAGGCCTGATGAATTTCTACAAGTAAAAAACGTGCT
CAAAGATGGTCCTGCCGCTCAGGATGGGAAAATTGC
Sequence Type mRNA
Unitrap ID UNI9560

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 103858270..103884139 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052539 (Magi3) NM_133853 membrane associated guanylate kinase, WW and PDZ domain containing 3 Gene [Source:MGI (curated);Acc:Magi3-002]

 
Come back to gene ENSMUSG00000052539


For any suggestions or comments, please send an email to unitrap@crg.es