Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XE517
Clone ID XE517
Vector pGT1Lxf
Project baygenomics

Sequence tag XE517
Sequence
TGAGAGTCCTCGTGAGCACAAAGCCAAGAGAGACCGTTAAGATTCCAGATTGTGCAGACGGGCTTGGTTTCCAGATCAGA
GGCTTTGGACCTTCAGTTGTTCATGCGGTGGGAAAAGGTACTGTGGCTGCAGCAGCTGGCCTTCATCCAGGACAGTGTAT
TATCAAAGTGAATGGAATCAATGTCAGCAAAGAGACACATGCCAGTGTCATCGCACATGTCACAGCCTGCCGGAAATACA
AACGGCCAATGAAGCAAGATTCCATACAGTGGGTTTACGACAGTCTTGAAAGTGCTCAGGAAGACATTCAGAAGTCCCAC
TCAAAGCCCCCTGGAGACGGGGCTGGAGATGCTTTTGAGTGCAAAGTAGA
Sequence Type mRNA
Unitrap ID UNI9568

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11132848..11146437 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048960 (Depdc2) NP_001028808 phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2 Gene [Source:MGI Symbol;Acc:MGI:1923385]

 
Come back to gene ENSMUSG00000048960


For any suggestions or comments, please send an email to unitrap@crg.es