Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XD137
Clone ID XD137
Vector pGT1Lxf
Project baygenomics

Sequence tag XD137
Sequence
CAGGTGCGTTCCAAGATGGCGGCCCTCAGGGCTCTGGTGTCAGGCTGCGGGCGGCAGCTCCAAGCGTTCCTGGCAGGCCC
CGCTGCCACTGGCTGGTTATGGCTTCCAGCTCGCGGGTTGAGAGA
Sequence Type mRNA
Unitrap ID UNI9576

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46247952..46248076 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023967 (Mrps18a) NM_026768 mitochondrial ribosomal protein S18A Gene [Source:MGI Symbol;Acc:MGI:1915815]

 
Come back to gene ENSMUSG00000023967


For any suggestions or comments, please send an email to unitrap@crg.es