Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XD084
Clone ID XD084
Vector pGT1Lxf
Project baygenomics

Sequence tag XD084
Sequence
CGCGCCGTCGCCCCCGACGGGGAGGACCATGGCGAAGGTGGAACAGGTCCTGAGCCTCGAGCCCCAACACCAGCTCAAGT
TCCG
Sequence Type mRNA
Unitrap ID UNI702

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 173563166..173563249 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054455 (Vapb) NM_019806 vesicle-associated membrane protein, associated protein B and C Gene [Source:MGI (curated);Acc:Vapb-001]

 
Come back to gene ENSMUSG00000054455


For any suggestions or comments, please send an email to unitrap@crg.es