Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XE704
Clone ID XE704
Vector pGT1Lxf
Project baygenomics

Sequence tag XE704
Sequence
TGGTTGTGAGCTCTTCTAGATGGTTTTTCTTTCTTCTTTAGGCGCTGCCCCGTGCGCTCCGGCACCTTCGGCAATTTCCG
TCGGGCCCTGGCCGCCATTTTCTCGCCGCTTGTGTGGCTCGCTGGCTGCGTGGCTCGGTTCTTGGGAGCGAAGCTTTGTC
CGGTTCGGCAATGGACGGAATTGTCACTGAGGTTGCTGTTGGTGTGAAGAGAGGATCTGACGAGCTACTCTCAGGCAGTG
TTCTCAGCAGCCCCAACTCTAATATGAGTGGCATGGTAGTTA
Sequence Type mRNA
Unitrap ID UNI5621

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 119464624..119486256 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028134 (Ptbp2) NM_019550 polypyrimidine tract binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1860489]

 
Come back to gene ENSMUSG00000028134


For any suggestions or comments, please send an email to unitrap@crg.es