Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XD183
Clone ID XD183
Vector pGT1Lxf
Project baygenomics

Sequence tag XD183
Sequence
AGAAGCTGGAGAAACTCGGCGTGTATTCCGCCTGCAAGGCAGAGGAGTCCTGTAAATGCAATGGCTGGAAGAACCCTAAC
CCCTCTCCTAGTCCACCAAGAGGAGACCTCCAGCAGATAATTGTCAGTTTGACAGAATCCTGTCGAAGTCTGTAGCCATC
GCCCCTT
Sequence Type mRNA
Unitrap ID UNI9591

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53706866..53750312 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000708 (Kat2b) NM_020005 K(lysine) acetyltransferase 2B Gene [Source:MGI Symbol;Acc:MGI:1343094]

 
Come back to gene ENSMUSG00000000708


For any suggestions or comments, please send an email to unitrap@crg.es