Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XE732
Clone ID XE732
Vector pGT1Lxf
Project baygenomics

Sequence tag XE732
Sequence
GTGTGCAGCACGTGGGGGCGGTGCCGTCGGAGACGCAGGTCCCTCCTGGTCGTGCCGGGCTCCTAGCGGCTGGAGCAAAA
ACGGAGGTTGAAATTTACCTGGCTTCCATGGAGGCATCAGCTGCGGAGCAGCCGAGCTCACCGCCCCCGCCTCTCGGGGA
CCACTGCATCCATGACGGTGACTTCGTGGTGCTGAAGCGAGAAGATGTGTTCAAATGCAGTGCAAGTCCAGCGGAGAAA
Sequence Type mRNA
Unitrap ID UNI9592

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 132641540..132641775 231
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037376 (Trmt6) NP_780322 tRNA methyltransferase 6 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Trmt6-001]

 
Come back to gene ENSMUSG00000037376


For any suggestions or comments, please send an email to unitrap@crg.es