Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST19354
Clone ID OST19354
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST19354
Sequence
AACCTTGGAATACCGACACCTNCACCCCCCGAGTGANNGGAGANCCTCACAGACTCTGCACCTCAGCTGAAGGGAACGAA
NGATGAACAATNTATACAACTGNCCCCAGTACCGNCATCACTCATAGCACCAGCAGCAACTATTTCCAAAGAAGCAATCC
TCCAGGCCAAGTCCCAGGAGACCTCACAGAACANCAAGGCTGATTCCAAAGGAGCCTAAGGATCCCTTGAAGGTGGCGCT
CCCTCTCTTCAGTCACTCCGCTCAGCAGTGGCGTCCACAAAGGAATTCCAGCTAAGACTGTCTGGCTTGAGATAAAGGAT
CAGCCATTAAGTCGTTGGAGGCCTTGTGACCATCCCAGAGATGCAAGCAGTGACACCAAGNTCAGGCCATTTANAGAAGC
TTAATTACANGNCCATCTCTACTGGATAATTTTGTC
Sequence Type mRNA
Unitrap ID UNI28812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26688998..26690868 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037363 (Letm2) NP_766600 leucine zipper-EF-hand containing transmembrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:2444979]

 
Come back to gene ENSMUSG00000037363


For any suggestions or comments, please send an email to unitrap@crg.es