Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST19150
Clone ID OST19150
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST19150
Sequence
GATTGCTGTGGAAGAGAAACCATCCAGATTTCAGTCATGCAGCAACTGGAGGATGGTGGCCCTGACCCACTTGTCTTTGT
TTTAAATGCAAATTTATTGTCAATGGTTAAAATTGTAAATTGTAAGTTAGAATTTTTTAATTAAAAACAATTTAAACACA
AAAAAA
Sequence Type mRNA
Unitrap ID UNI20101

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108357475..108357632 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034557 (Zfyve9) NM_183300 zinc finger, FYVE domain containing 9 Gene [Source:MGI (curated);Acc:Zfyve9-001]

 
Come back to gene ENSMUSG00000034557


For any suggestions or comments, please send an email to unitrap@crg.es