Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST19005
Clone ID OST19005
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST19005
Sequence
GGGCACTGGGAAGGGGTAGATTGTGCGGCTGGATCCATTCATCGAAGTCCCATGAGAAGCAGGATCTAGATCCAGGCCAG
CCTTCGGCACTGGCCAGCAAGGAGCATGGACTGTTGCCAGCTGCATGTGATAAACGACCTGGACCCAGCCGGCCTCGGAC
GGACGGGCGGCTTCTTTCTCAACTAACGTCTCTCCCCCTGCTCTGGATGGTGTACGGCTTTACAGAGGGGCTTTCTTTAT
GGTTTTACCAGGGTCTGCTGGGGACAGACTCGAGGCTTACCTTTGCACATGTTAAAGAAAATAAAA
Sequence Type mRNA
Unitrap ID UNI28819

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103677390..103677695 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000125 (Wnt3) NM_009521 wingless-related MMTV integration site 3 Gene [Source:MGI (curated);Acc:Wnt3-001]

 
Come back to gene ENSMUSG00000000125


For any suggestions or comments, please send an email to unitrap@crg.es