Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRB022
Clone ID RRB022
Vector pGT1Lxf
Project baygenomics

Sequence tag RRB022
Sequence
TTATCCAGTCTTGTAAAATTGAATAGCTTGACCTTAGCTAGAAATTGCTTCCAGTTATATCCAGTGGGAGGTCCATCTCA
GTTTTCCACCATTTATTCCCTCAACATGGAACACAATCGAATCAACAAAATCCCATTTGGAATTTTTTCCAGAGCTAAAG
TGTTAAGTAAGCTGAATATGAAGGACAATCAGTTAACATCACTTCCTTTGGATTTTGGAACTTGGACCAGTATGGTAGAA
TTGAATTTAGCGACTAATCAGCTCACAAAGATCCCAGAGGATGTGTCTGGTCTCGTTTCCCTTGAGGTTCTGATCTTATC
GAACAACCTTCTAAAGAAGCTGCCCCACGGCCTTGGGAACCTCAGAAAGCTACGAGAGCTGGACCTGGAGGAGAACAAGC
TGGAGTCCTTGCCCAATGAGATCGCGTATCTCAAGGATCTGCAGAAATTAGTCTTGACAAACAACCAGTTGAGCACGCTT
CCCAGAGGCATCGGTCACCTTACCAACCTCACGCACCTTGGTCTTGGAGAGAACCTGCTCACTCACCTTCCTGAGGAAAT
C
Sequence Type mRNA
Unitrap ID UNI9604

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 54100846..54104467 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024976 (Shoc2) NM_019658 soc-2 (suppressor of clear) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1927197]

 
Come back to gene ENSMUSG00000024976


For any suggestions or comments, please send an email to unitrap@crg.es