Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRB025
Clone ID RRB025
Vector pGT1Lxf
Project baygenomics

Sequence tag RRB025
Sequence
AGGAGGAGAGCTGTGTTCCAGCCAGCCAGGAAACTAGCTTGGGACAAGACACCTCAGATCCTGCTTCCACCAGAACAGGT
GCCACTGCCAGCCCTTCAGCAGAAGCTCTGCCACCAAAGACCTATGTAAGCTGTCTCAGCAGCCCTCTGTCAGGCCCCAC
CAAGGACCAGAAGCCAAAGAACTCTGCACATCACATCTCCCTGGCTCCCTGCCCACCGCCAGTCACCCCCCAGAGGCAGT
CTCTGGAGGGGGCAAGTAACCCGAGAGGTGATGACAACTTTGTCGCCTGTATGGCCAACAACAGCCAGAGTGTCCTTTCA
GTTAGCTCCTTGGGGCAGTGCTCAGATCCTGTCAGTACTTCGGGGCTTGAAGACTCTTGCACAGAGACCATCTCAAGCTC
CGGAGACAAAGCTATCACCCCACCACTGCCAGTCAGTACTCAGCCCTTCAGCAACGGGGTGCTGAAGGAGGAGCTGTCAG
ACTTAGGGACCGAGGATGGATGGACCATGGATACAGAAGCAGATCACTCAGG
Sequence Type mRNA
Unitrap ID UNI9298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88705575..88706106 530
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018428 (Akap1) NM_009648 A kinase (PRKA) anchor protein 1 Gene [Source:MGI (curated);Acc:Akap1-002]

 
Come back to gene ENSMUSG00000018428


For any suggestions or comments, please send an email to unitrap@crg.es