Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST18822
Clone ID OST18822
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST18822
Sequence
GACAGCGCCTGACTGAGATGGAATGTTCTCAGGACCAGCTGAGGGATAGCCTCCAAAGCCTGCAACTTCTTTCAAAAACA
CCAGGATCTCGGAGCCAGCCCCTGCCTCTCAAAGCACCATGTGTCAATGGAGCTGATCTGTCAATGGGCACTTGAGCATT
TCACCCCACTCCATATATGGTCTGGAAGCCAAGAGAGCCACTACAGAGGATTTTCTGACTGCCTCAGCCCTTCATGGCCT
TCAGTGGGGGACAGAGTGGGAGGTGTCAATCACTCTGGTAACTGTGAGGTTGCCCAGTAAATCCATTTCAGAAAATCA
Sequence Type mRNA
Unitrap ID UNI28486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32527862..32528178 317
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052142 (A430107D22Rik) NM_178785 RIKEN cDNA A430107D22 gene Gene [Source:MGI Symbol;Acc:MGI:2444128]

 
Come back to gene ENSMUSG00000052142


For any suggestions or comments, please send an email to unitrap@crg.es