Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST18756
Clone ID OST18756
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST18756
Sequence
GGTTCCAAAGTGGCAGGAAGCCCCCTGGACCTTCACCCTCGGCCTGCTGTCCCTCCACTACGGCCTAGGAGCTTGGAGTG
GGGAGGACCATGGTGGCATCGTTGCCAAGGGTCTGGACACAGGCATGCTGGAGACTGGACCTTGCTTAGGACTGAGGCTG
GCCACAGTCTTGTCAGCGATCACCTTCCCCACCCCTACTTGTGGTGTTGCCTCAACATCCAATAAATGCTAAGGAGTGGA
Sequence Type mRNA
Unitrap ID UNI13957

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86697632..86697872 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056155 (Nanos3) NM_194059 nanos homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2675387]

 
Come back to gene ENSMUSG00000056155


For any suggestions or comments, please send an email to unitrap@crg.es