Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST18724
Clone ID OST18724
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST18724
Sequence
AGCTCTCAGCCTGACCTGAACATCTGAGGTTGCTCTGACCCGATGCCGTCTGCCCCTCTGATACTCAGCTTCTGGATCAT
GAACCTCGAAACTTTTTTTTAGAGGGCTGCCCCACCCACTGCTCTCTCTCCTCCCCGCCTCACACCACCCTCCTCCCCTC
TCCATAGTGAGTTAGAAGAATCTAAAGGGATTGGCTGCGTTCTCTGATTCTGTGGAACTTCTTATAAAATCATTGCTCTA
CAAGAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28826

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127142386..127142627 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031981 (Capn9) NM_023709 calpain 9 Gene [Source:MGI (curated);Acc:Capn9-001]

 
Come back to gene ENSMUSG00000031981


For any suggestions or comments, please send an email to unitrap@crg.es