Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST18709
Clone ID OST18709
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST18709
Sequence
AAAAGAAATCTGTGGACATCGAAGTGGACCTAATTCGCTTTTCTTTTTAAAAGCTTCTGAAGACAAAAAGCAGCTTAAAA
TCTAACTAAGGAATAAAAACACTGCTTACTAAATAAA
Sequence Type mRNA
Unitrap ID UNI15869

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69709268..69709373 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051730 (Mettl5) NM_029280 methyltransferase like 5 Gene [Source:MGI (curated);Acc:Mettl5-001]

 
Come back to gene ENSMUSG00000051730


For any suggestions or comments, please send an email to unitrap@crg.es