Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST18675
Clone ID OST18675
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST18675
Sequence
AGGATTTTTACGTGGTGAGAAGTGCCTGGATCAGCTAATTGAGAGATTGCTTCAATCAGCAGATGAAGAGGCCATTTCCG
AATTTTTGGATGAAAGCCTTCAATCAGTGAAATAAATTATTTGTTATATAAATGAAGTGGACTTTGATCAAGAAAAAAAA
A
Sequence Type mRNA
Unitrap ID UNI28731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 79823206..79823363 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022022 (Mtrf1) NM_145960 mitochondrial translational release factor 1 Gene [Source:MGI Symbol;Acc:MGI:2384815]

 
Come back to gene ENSMUSG00000022022


For any suggestions or comments, please send an email to unitrap@crg.es