Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST18182
Clone ID OST18182
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST18182
Sequence
GGTAGTGAAGCCCACGCTCCTTAATAAAGTTCCCTAACAGAAGAGACAAACCTAAACTCAGTGCCTCAGAAGCTTTGGGG
TCTGCAGCGCTCCCCTCCCACTCCTCTGCAATTTCACAGCATTCTAAAGGAAGTACGTCCCCCGATTTACTGATGCACCA
GGGGCCACCAGACACTGCAGAAATTATAAAATCATTACCTCANAAATACAGAAGGAAACCTATGTCTCAAGAGGAAATGG
AATTTATCCAGCGTGGGGGTCCAGAGTGACCGTCGTGGCTGCTGCTTGTCACCAGACAGAAGGGTTAGCTTTACAATAAA
GGACTTCCACAATGTCAAATGAAAAGTCATATATTAAACAANCCTTAATAAATATTCTGTGAGCAGAATGAAGTACAGAA
ACTCCAGGTGGTCACTTGTATC
Sequence Type mRNA
Unitrap ID UNI7918

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101506059..101511187 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061474 (Mrps36) NM_025369 mitochondrial ribosomal protein S36 Gene [Source:MGI (curated);Acc:Mrps36-001]

 
Come back to gene ENSMUSG00000061474


For any suggestions or comments, please send an email to unitrap@crg.es