Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST18104
Clone ID OST18104
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST18104
Sequence
GGGTTCCAGGCAGAANTGTCTGACACCACCCCACGGACCAAGATGGCCCACCTNTCGCTGACAGATCAAGGACCGGGGAA
GCAGAGGAGGCAGAATCACCAACAGAACAAGATGTCTTGAAAGGACACTCATGACCTAGTGGCAGACACCCAGGCCACAT
GACCTCCACAGGCTTCCCTTTCCTCTATTCTTATGGCTGNTTTTGTTATTATTAATTTTAACTCTGCCCAGCCTCTTCCC
AACCCTCCCAATATCCACCGCTGGAGAGTCTTAACTAGGGAGACTTATGACAGACACAACACAGGCATAGGAACCCTGGA
CTG
Sequence Type mRNA
Unitrap ID UNI28845

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 96947363..96947685 315
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074153 (9330175E14Rik) RIKEN cDNA 9330175E14 gene Gene [Source:MGI Symbol;Acc:MGI:2443913]

 
Come back to gene ENSMUSG00000074153


For any suggestions or comments, please send an email to unitrap@crg.es