Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST17847
Clone ID OST17847
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST17847
Sequence
GAGCACAAAGCCCGTTTCAAAGGAGACTGACAAATTATCCCCAGCTGCCAGAAGGAGAATCCTTCCTGGACGCCTTCTTG
CCTCCTGTGAGTCTTCACCTAACCTGCTGCAAGAATGAACCTTCTCAAGTTCCTGGGAGGCACTGTCTTAGTCGCCTTCA
TGCTCTTCAGCTACTCGGAGCAAAACCAAGTGAATGTGCTGTGCTCGACAGATTGGTTCATGGTCACCGTTCACCCCTTC
TTGCTGAATAATGATGTGTATGTTCATTTTTACGAGGTGCACCTGGGCCTTGGTTGCCCTCCCAATCATGTTCACCCACA
TTTCTACCAGTTTCACTACCGCGTTACCGAATGTGGCATCCGCATCAAGGCTGTCTCTCCAGATGTCGTCATCTATAGCT
TCTGAGATTCACTATGCTTTCAAGGGCTCATCAACGAAA
Sequence Type mRNA
Unitrap ID UNI28854

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 50423685..50451653 374
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061082 (Plac1) NM_019538 placental specific protein 1 Gene [Source:MGI (curated);Acc:Plac1-001]

 
Come back to gene ENSMUSG00000061082


For any suggestions or comments, please send an email to unitrap@crg.es