Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST17843
Clone ID OST17843
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST17843
Sequence
GGCTGCAGGTGATGTGAGCCAGGAGCCAAAGAGAAGATCACGCCCGACTGTCTGCTATGCCTGTGCCCTTTACACCGGAG
TTGAAACCTAAAAGAGCATCAACTTCAAGGAAAACCAAGACCACAAATGTCGTGGAAGAAAACAAAGATGCAAGTACCAT
ACCAATTCCTGAAACCAAGCCAGAAGATGTTAAAGACGAATGCAACATGGAAAATGCTGAAAATGGAGAAGCCAAGATTA
TGGAGGCACCCATTCCTAAAATGGAAGCTGAGGAAGTAAAAGAACAGATAAATGAAGACACTGAAGAAGATGGAGGAGAA
AAGAAAGAAGCAGTGGCAGCAGAAGCCAAAGATGATGAGCTAAAAGCAAACATTCAAGATGTGGAGAAAGATGAAGATGG
AAAAAGAGCACAAAGATACAGGTGAGGAGGTGGAAGACGGA
Sequence Type mRNA
Unitrap ID UNI28857

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 106201216..106206785 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031245 (Nsbp1) NM_016710 nucleosome binding protein 1 Gene [Source:MGI (curated);Acc:Nsbp1-001]

 
Come back to gene ENSMUSG00000031245


For any suggestions or comments, please send an email to unitrap@crg.es