Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST17839
Clone ID OST17839
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST17839
Sequence
GACCCAGTTTATGGAGCCGGCATATATTTCACCAAGAGCCTCAAAAATCTAGCAGACAAGGTCAAGAAAACCTCAAGCAC
AGACAAGCTAATCTATGTGTTTGAGGCAGAAGTACTCACAGGGTCCTTCTGTCAGGGTAATTCCTCAAATATCATCCCTC
CACCATTGAGTCCTGGGGCCTTAGATGTCAATGACAGCGTAGTTGACAATGTTTCCAGCCCTGAAACCATTGTTGTTTTT
AATGGCATGCAGGCCATGCCCCTGTACTTGTGGACTTGCACACAGGATAGGACATTCTCACAGCATCCGATGTGGTCACA
GGGCTACTCATCAGGACCAGGAATGGTCTCTTCGCTGCAGTCCTGGGAATGGGTCTTAAATGGCAGCTCTGTTTAGTGTC
TACATCAGTTTAACAAGCAGAAGGGGTTGAGAGAACTGACAAAATGATAAATA
Sequence Type mRNA
Unitrap ID UNI13347

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35971920..35972372 453
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022906 (Parp9) NM_030253 poly (ADP-ribose) polymerase family, member 9 Gene [Source:MGI (curated);Acc:Parp9-001]

 
Come back to gene ENSMUSG00000022906


For any suggestions or comments, please send an email to unitrap@crg.es