Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST17700
Clone ID OST17700
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST17700
Sequence
GCCCAACAGGCAGGACTCGTGAAATCACAATGCCTTCCAGGAGTTACACCCCGTACACGAGAGTCCTGGAGTTATCCTCA
AAGAAAACGCTGACTTAGGCACTCAGAGACATACGCCTCTTGGGGATGCTGCAAAGCCCTGGAAGCCTGTGACTTAAAAG
TCCGGAGAGGGTGGCAATTGCTTCCTCGAAGACATGGTGTCACCTTGAATAGGAATCTCAGGCAATCGGAGACAGAGAGA
GCCAGCAAGGGCTGGTACCTGAGGTCGTATTTCAGACACCCACCTGACCCTGCCACTCACAGCCGTCGTTTGTTTTCCAT
GGATGCAGAAGTCCAGGTTTCACCGTCTATTTTCTGGTTTACTCGATTTTGGNTTGGAGGGAAAAGGGCATTTAGTT
Sequence Type mRNA
Unitrap ID UNI28863

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71352643..71353037 379
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041361 (Gcom1) NM_001033208 GRINL1A complex locus Gene [Source:MGI Symbol;Acc:MGI:2142908]

 
Come back to gene ENSMUSG00000041361


For any suggestions or comments, please send an email to unitrap@crg.es