Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XE228
Clone ID XE228
Vector pGT1Lxf
Project baygenomics

Sequence tag XE228
Sequence
AGATAAAATTGGAATGGAAATTATGTCCTATCAGATTTGGGTGGATTACATCAATTTCTTAAAAGGAGTGGAAGCTGTAG
GATCTTATGCAGAAAATCAGAGAATGACTGCTGTCCGAAGAGTTTATCAACGAGGTTGTGTTAATCCAATGATCAACATT
GAACAACTCTGGAGAGACTACAACAAGTATGAAGAGGGTATCAATATTCATTTAGCTAAAAAGATGATTGAAGATCGGAG
TAGAGACTACATGAATGCTAGACGTGTAGCAAAGGAATACGAGACAGTCATGAAAGGTTTGGACCGCAATGCTCCTTCAG
TGCCTCCTCAGAATACTCCTCAAGAAGCTCAGCAAGTGGACATGTGGAAGAAGTACATCCAGTGGGAGAAGAGCAACCCT
CTTCGCACAGAGGACCAGACCCTGATAACCAAAAG
Sequence Type mRNA
Unitrap ID UNI9630

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 104486764..104489770 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027176 (Cstf3) NM_145529 cleavage stimulation factor, 3' pre-RNA, subunit 3 Gene [Source:MGI (curated);Acc:Cstf3-001]

 
Come back to gene ENSMUSG00000027176


For any suggestions or comments, please send an email to unitrap@crg.es