Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST17601
Clone ID OST17601
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST17601
Sequence
ATGGTGCCAGCCCAAAAGATGTTTTAGCAACGTAGAAGGCTACTGTAGGAAGAAATGCAGATTANGTGGAGATATCTGAG
ATGGGATGCCTGCATGGGAAATACTGTTGTGTTAACGAGCTGGAGAACAAAAAGCACAAGAAGCACTCAGTCGTTGAGGA
GACAGTCAAACTCCAAGACAAGTCAAAAGTACAAGACTATATGATCCTGCCCACGGTCACATACTACACCATCAGTATCT
GAATGAACCACTTGTTCACGAAGGCCGTTGTCCCCTGCAGCCCCATGGAATCCAGTGGGCTGCTTCTGTCCTGTCTCTTT
CCTTCTGTGAACTTGAGTCCGCACACAATAAAGTTCGACCCTTTTGCCTGTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28868

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152305090..152305461 361
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049560 (Defb20) NM_176950 defensin beta 20 Gene [Source:MGI (curated);Acc:Defb20-001]

 
Come back to gene ENSMUSG00000049560


For any suggestions or comments, please send an email to unitrap@crg.es