Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST17353
Clone ID OST17353
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST17353
Sequence
GTCCTGGTTCTCACTCAGCGTCACAGAATGAGGGGGTACACGACGGTTATTTATGCGCTACTACAGGGATTGGAAAATGT
CCCGTGAGTACTCTACAACAAGAAGTTTCGACAGGCAGAAGAACTCCAAGGAGTGCTCTCAGAATGACCCTGGACTCCCC
GAAGCATTGGAAGCCTTGAAGAGGCTCAAGCTCTCTTCTGGGTACCAAAGCAGAGATGGCATGTCACAAGATTTCTGACT
TTTCAACTTCTTTGTGGGGGCAGGCGTCTGTCTATGGGAGAAGGTACATTAATAATAAAGCGTGCATTCATAGAGTCCAA
AAAGAAAA
Sequence Type mRNA
Unitrap ID UNI28880

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16489048..16489372 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074365 (Crxos1) NM_001033638 Crx opposite strand transcript 1 Gene [Source:MGI (curated);Acc:Crxos1-001]

 
Come back to gene ENSMUSG00000074365


For any suggestions or comments, please send an email to unitrap@crg.es