Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST17328
Clone ID OST17328
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST17328
Sequence
AAGGCTGGTCTCAAACTTCTGAGCCTCTTTGTTCCATATCAAGACAGCTGGAATGGCAGCGGTTACCACTATGGCCAGCT
CATTCAGTGCTGCAGACTGAACGCAGGGCTCTCTACACACCAAGCAGGCGTTCGGCCAACTGCTATGGCTCCAACCCCAT
GTTCTGGACTCTAACTAACTTCTTAAGGGCTAAGAAACACCTAAGAGCTAGTTTTGTCCCCTGACCTGGACACTGCGGTG
AGTTTACAGAACTTACAATCACCCTGTTTTCTGTAGAAGCTGCCTCAACCATCTTGACATGTTTCAAATGTGTGTTCACT
TTCCTCTTCAATGTCCAAGTGCACCAAGCTTGATGGAACGCTGACACAAGTCTAACTGGATCTGTTTTGAATTTGCAAAT
TGACTCTGCATCTAAATAGATATTTTGGTG
Sequence Type mRNA
Unitrap ID UNI28881

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 130386238..130386661 424
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060029 (4930473A02Rik) RIKEN cDNA 4930473A02 gene Gene [Source:MGI Symbol;Acc:MGI:2447823]

 
Come back to gene ENSMUSG00000060029


For any suggestions or comments, please send an email to unitrap@crg.es