Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XE642
Clone ID XE642
Vector pGT1Lxf
Project baygenomics

Sequence tag XE642
Sequence
AGTTAATGCTGCTGATAACAAACAAAGGGACCCAAAAATGTCTTGTATTAGAGTCACAATTCATCCAGAAAATAATGTAA
TTAGCATCTGGAAT
Sequence Type mRNA
Unitrap ID UNI9638

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98880228..98883090 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020914 (Top2a) NM_011623 topoisomerase (DNA) II alpha Gene [Source:MGI (curated);Acc:Top2a-001]

 
Come back to gene ENSMUSG00000020914


For any suggestions or comments, please send an email to unitrap@crg.es