Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST17267
Clone ID OST17267
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST17267
Sequence
GCAGACCAAGGCTGAAATAATTAAAAGAGAAAATAACGAAGAGGTTAATTGCTGAGGAAGAACAAAAA
Sequence Type mRNA
Unitrap ID UNI28882

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 64448251..64448315 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037921 (Ddx60) NP_001074684 DEAD (Asp-Glu-Ala-Asp) box polypeptide 60 Gene [Source:MGI Symbol;Acc:MGI:2384570]

 
Come back to gene ENSMUSG00000037921


For any suggestions or comments, please send an email to unitrap@crg.es