Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST17261
Clone ID OST17261
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST17261
Sequence
GGCTTCCTAAGGGATAAGACAGGAGACTTCAGTGCCTCTTTCCTGGTGTGCAGCTCTTTCATCCTCTCTGGCAGTTTCAT
CTACATGGGGCTGCCCAGAGCCCTCCCCTCCTGCCGTCCAGCCTCACCTCCAGCAACCCCTCCACCAGAGAGAGGGGAGC
TGCTCCCAGTTCCACAAGTCTCCCTGCTTTCCGCAGGGGGTACTGGCTCCATCCGGGATACCACTTGTTGATCATTTTCT
TGGTTGACCTCCTTCCCTAATAAAGAATTTTTATCTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28850

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70029638..70029915 278
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040938 (Slc16a11) NP_694721 solute carrier family 16 (monocarboxylic acid transporters), member 11 Gene [Source:MGI (curated);Acc:Slc16a11-003]

 
Come back to gene ENSMUSG00000040938


For any suggestions or comments, please send an email to unitrap@crg.es