Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG226
Clone ID XG226
Vector pGT1Lxf
Project baygenomics

Sequence tag XG226
Sequence
GGGGGGGGGGGGTTTTTTTAAGGTTTTTTTTTTTTTTTTTCATGACTGGCCGCGCGATGGACCCGCTGCCCTCGCCGGCA
GTCGCTGCAGCTGCTGAGGCGGAGGCTGACGAGGAGGCGGATCCGCCGGCGA
Sequence Type mRNA
Unitrap ID UNI9642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140865105..140865196 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029560 (Snx8) NM_172277 sorting nexin 8 Gene [Source:MGI Symbol;Acc:MGI:2443816]

 
Come back to gene ENSMUSG00000029560


For any suggestions or comments, please send an email to unitrap@crg.es