Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST17140
Clone ID OST17140
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST17140
Sequence
ACCTATGCATTGCTTATATGCTGGTGACATTGACTTATCTCTATATTGGTATCCTGGTTTTTGCCTCATTCCCTTCGCCT
CCATTACCCAAAGATTGTATTGAACAGAACTTNTTAGACAACTTCCCCAGCAGTGACATCCTGTCCTTCATTGCAAGGAT
ATTCCTGCTGTTCCAGATGATGACTGTATATCCGNTCTTAGGCTACTTGGCTCGTGTCCAGCTCTTGGGCCATATCTTCG
GTGACATTTATCCTAGCATTTTCCATGTGCTGATTCTTAACTTAGTTATTGTGGGAGCTGGAGTGACCATGGCCTGTTTC
TACCCAAACATAGGAGGGATCATAAGGTATTCGGGAGCAGNATGCGGCCTGGCTTTC
Sequence Type mRNA
Unitrap ID UNI28888

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 113513413..113521737 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047789 (Slc38a9) NM_178746 solute carrier family 38, member 9 Gene [Source:MGI Symbol;Acc:MGI:1918839]

 
Come back to gene ENSMUSG00000047789


For any suggestions or comments, please send an email to unitrap@crg.es