Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST17058
Clone ID OST17058
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST17058
Sequence
GGTTCCCGGATATTTGTCAATGGACGATTTATTGGAGGCGCAGCGGACACTCACAGGCTTCACAAAGAAGGGAAATTGCT
GCCTCTGGTTCATCAGTGTTATTTAAAAAAAAAACA
Sequence Type mRNA
Unitrap ID UNI19492

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 145593637..145593753 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018196 (Glrx2) NM_001038592 glutaredoxin 2 (thioltransferase) Gene [Source:MGI Symbol;Acc:MGI:1916617]

 
Come back to gene ENSMUSG00000018196


For any suggestions or comments, please send an email to unitrap@crg.es