Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0151
Clone ID AY0151
Vector pGT0lxr
Project sanger

Sequence tag AY0151
Sequence
AGATGAGGATGATGGCCGAGACCCTCTCCCCCCCCAGCAGGCTCACCCAGAAGCTGCTATTGGAGACTGCTGCCCCGAGG
GCCCCCTCAAGTAGACGGTACAACGAAGGCAGAGAGCTCTGGTATGGATCTTGGAGGGAGCCCGTCAACCCCTACTACGT
CAACTCTGGCTATGCCCTGGCCCCAGCCACCAGTGCCAATGACAGTGAGCAGCAGAGCCTGTCCAGTGATGCTGACACGC
TATCCCTTACGGACAGTAGTGTGGATGGAATCCCCCCATACAGGATCCGTAAGCAGCACAGAAGGGAGATGCAGGAGAGT
ATCCAAGTCAATGGGCGGGTACCTCTACCTCACATTCCTCGCACTTACCGAATGCCAAAGGAGATCCGGGTAGAGCCACA
GAAATTTGCTGAAGAGCTTATTCACCGTCTAGAGGCTGTCCAGCGCACTCGAGAGACTGAAGAAAAGTTGGAGGAACGGC
TGAAGCGTGTACGCATG
Sequence Type mRNA
Unitrap ID UNI1059

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26280402..26321259 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024182 (Axin1) NM_009733 axin 1 Gene [Source:MGI (curated);Acc:Axin1-001]

 
Come back to gene ENSMUSG00000024182


For any suggestions or comments, please send an email to unitrap@crg.es