Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST16947
Clone ID OST16947
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST16947
Sequence
ATCATGAGAAAGCTAGACCACTGTAACATANTCCGACTGCGGTATTNCTTCTACTCGAGTGGCGAGAAGAANGATGAGGN
CTACCTTAACCTGGTGCTGGACTATGTTCCGGAGACAGTGTACAGAGTCGNCAGACACTATAGTCGAGCCAAGCAGACAC
TCCCTGNGATCTATGTCAAGTTGTATATGNATCAGCTGTTCAGAAGTCTAGCCTATATCCATTCCTTTGGAATCTGCCAT
CGAGACATTAAACCACANAACCTNTTGCTGGATCNTGATACAGCTGTATTAAAACTCTGTGACTTTGGAAGATGCAAATG
CTANCTANNTTCNAGGAGAGCCCNATGTTTNATAATNTNTTNTACTCTGGTACTTCATGGG
Sequence Type mRNA
Unitrap ID UNI4411

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38170765..38188030 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022812 (Gsk3b) NM_019827 glycogen synthase kinase 3 beta Gene [Source:MGI (curated);Acc:Gsk3b-001]

 
Come back to gene ENSMUSG00000022812


For any suggestions or comments, please send an email to unitrap@crg.es