Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST16930
Clone ID OST16930
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST16930
Sequence
GGTAGCCAGTGTCTGTCTGATACTAAATGGTAAATGAACTACATGTTTTTAAGGAAACAAAAATATTTTTGTAATCATCA
AATTTATACTAGCTATATGGGTATTAGCATATCCAGTAATTATGAGTCTAGAGTAATTTTTACATATTTTTATATTATTG
NCCTCTCAGTTACTGAATGAATGGAAAACAATCATGT
Sequence Type mRNA
Unitrap ID UNI14034

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65804961..65805157 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029201 (Ugdh) NM_009466 UDP-glucose dehydrogenase Gene [Source:MGI (curated);Acc:Ugdh-001]

 
Come back to gene ENSMUSG00000029201


For any suggestions or comments, please send an email to unitrap@crg.es