Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST16884
Clone ID OST16884
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST16884
Sequence
TGACCCACACAGTGAANAGGGAGCCCAGGACTATGTATCANTGTTCAAGCNCCAGATGCTGTGNGACATGAACAGAGTGC
TGGAGCTGCGTCTGATTCTGCGGCAGCCATCACCACTGTGGCTGTCTTTCACAGTGGAGGAACTGCAGATCTACCAACAG
GGACCAAAGAGCCCCTCCTTGGCGTTCCCCAAGTGGCTTTCCCACCCAGTGTCCAATGAGCANCCTGNTNCCCGCCTTGA
GGGTCTCCCAGATNCCANCAGAGTGTCCTTTTGA
Sequence Type mRNA
Unitrap ID UNI21869

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108195789..108197247 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032606 (Nicn1) NM_025449 nicolin 1 Gene [Source:MGI Symbol;Acc:MGI:1913507]

 
Come back to gene ENSMUSG00000032606


For any suggestions or comments, please send an email to unitrap@crg.es