Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG519
Clone ID XG519
Vector pGT1Lxf
Project baygenomics

Sequence tag XG519
Sequence
CAGACCTTCCTGCGAGTGCGAGCCAACCGGCAAACCCGACTGAAT
Sequence Type mRNA
Unitrap ID UNI9659

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116961632..116961676 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es