Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG521
Clone ID XG521
Vector pGT1Lxf
Project baygenomics

Sequence tag XG521
Sequence
GTATGGGTCCTTAGTGTGCATGTCCAAGGACAACTTCGAGACGTTTCTTTTTGCCACCGTTTCAAACCGAGAGCACGAAG
ATCTCTGCCAAGGGATTGTCCAGCTGTGCTTCAACGAGCAGAGCCAGCAGCTGCTGGCTGACGTTCAGCCCTCTGACTCT
TTCCTCATGGTGGAGACAACAGCCTACTTTGAGGCTTATCGGCATGTCCTGGAAGGGCTACAAGAGGTCCAGGAAGAAGA
TGTCCCCTTCCAGAGGAACATTGTGCAGTGTGACTCCTATGTGAGGAACCCGAGGTACTTGCTAATGGGTGGCAGATATG
ACTTCACCCCCCTCATGGAGAATCCCTCAGCCATGAGGAAGTCTCTGAGAGGTGCTGAGGCTTTGAGACATCCTAGGATT
AATGTCTTTGACTTTGGCCAATGGCCCTCCAAAGAAGCCCTGAAGCTGGATGACTCCCAGATGGAAGCCTTACAGTTCGC
CCTCACCAAGGAGCTGGCTATCATTCAAGGACCTCCTGGAA
Sequence Type mRNA
Unitrap ID UNI9661

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166880657..166881177 521
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039501 (Znfx1) NM_001033196 zinc finger, NFX1-type containing 1 Gene [Source:MGI (curated);Acc:Znfx1-001]

 
Come back to gene ENSMUSG00000039501


For any suggestions or comments, please send an email to unitrap@crg.es