Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST16605
Clone ID OST16605
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST16605
Sequence
CCAGACAGTCACCTGTATCCCCAACTGCACTTGGCGAAACTATAAGGCGGAAGTGCGCTTCGAGCCACGCCCCAAGCCCG
CGCGTTTCCTCAGCACCACCATCGTCTACCCCAAGTACCCCAAAACCGTCTACACCACCACTCTGGATTACAACTGCCAC
AAGAAGCTGAGGAGGTTTCTGNCCAGTGTGGAGCTCGAGGCCACGGAGTTCCTGGGCAAGCGATGGGCTANCCNATGAAT
GGTGACTCACTACTTGAGGTTGGACCA
Sequence Type mRNA
Unitrap ID UNI28916

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75835388..75835655 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020846 (1500005K14Rik) family with sequence similarity 101, member B Gene [Source:MGI Symbol;Acc:MGI:1923816]

 
Come back to gene ENSMUSG00000020846


For any suggestions or comments, please send an email to unitrap@crg.es