Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG552
Clone ID XG552
Vector pGT1Lxf
Project baygenomics

Sequence tag XG552
Sequence
AGCCTGCTAAGGACAGCTGGGACGCAGCCCTACGTTGGCACCGATACTACTGAGAACTTCGCAGTTGCTAATGGGAAAAT
ACTTGAATCCCCGGGCGAGGACACTGCTGCCAACGGGGCAGAACTGCACACCGACGAGGGTGCAGACCTGGACCCTGCGA
AGCCGGAGAGCCAGTCACCTCCTGCCGAAAGTGCGCTCTCTGCCTCTGGCGCCATCCCCATTAGCCAGCCTGCAAAGTCC
TGGGCTAGTCTCTTTCATGATTCTAAGCCCTCTGCCTCCTCACCCATGGCGTATGTGGAAACTAAGTGTTCCCCCCCTGT
CCCATCCCCCCTGGCCTCTGAAAAACAGATGGAAGTCAAAGAAGGGCTTGTTCCAGTGTCAGAGGATCCTGTAGCCATAA
AGATTG
Sequence Type mRNA
Unitrap ID UNI9663

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122465630..122466035 406
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031826 (Usp10) NM_009462 ubiquitin specific peptidase 10 Gene [Source:MGI Symbol;Acc:MGI:894652]

 
Come back to gene ENSMUSG00000031826


For any suggestions or comments, please send an email to unitrap@crg.es