Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST16252
Clone ID OST16252
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST16252
Sequence
GCCGCTGTGAGCGCTTGCCTTGCCATGAGAACCAGGAGTGCCCCAGGCTGCCTCTGAGAATAACCTACTACCACCTCTCT
TTTCCCACCAACATCCAAGTGCCAGCGGTGGTTTTCCGCATGGGCCCTTCCAGTGCTGTCCCTGGGGACAGCATGCAGCT
GGCCATCACCGCTGGCAATGAGGAGGGCTTTTTCACCACTCGAAAGGTGAGCCACCACAGTGGGGTGGTGGCCCT
Sequence Type mRNA
Unitrap ID UNI14088

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 85081874..85082108 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006369 (Fbln1) NM_010180 fibulin 1 Gene [Source:MGI Symbol;Acc:MGI:95487]

 
Come back to gene ENSMUSG00000006369


For any suggestions or comments, please send an email to unitrap@crg.es