Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST16115
Clone ID OST16115
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST16115
Sequence
GGACAATTTCTACTTCACTGNAGTGCACGATGCCAGCGACAAGAGGTTCCAGGAGACCTTTGAGGACGTGTACTCTGACC
GTGCCCTTC
Sequence Type mRNA
Unitrap ID UNI17556

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21934066..21934358 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001348 (Acp5) NM_007388 acid phosphatase 5, tartrate resistant Gene [Source:MGI Symbol;Acc:MGI:87883]

 
Come back to gene ENSMUSG00000001348


For any suggestions or comments, please send an email to unitrap@crg.es