Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG833
Clone ID XG833
Vector pGT1Lxf
Project baygenomics

Sequence tag XG833
Sequence
GGCCATAGAGAAGGATGCAGTGACTTATGATGATGTGCACGTGAACTTCACTGGGGAAGAGTGGAATTTGCTGGATCCTT
CCCAGAAGAGTCTCTACAAAGATGTGATGCTGGAGACCTACTGGAACCTCACTGTTATAGGCTACACTTGGAAAAACCAT
CATATTGAAGGACGTTGTCATAGTTCAAGAAGAAATGAA
Sequence Type mRNA
Unitrap ID UNI9679

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 17821722..17907851 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079167 (CT030170.10)  

 
Come back to gene ENSMUSG00000079167


For any suggestions or comments, please send an email to unitrap@crg.es