Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST15962
Clone ID OST15962
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST15962
Sequence
CTGCATGCTTCACTGCGTCTGAGAAACCTTATAAACAAGATTGAGAACAAGATCGAGAGCATCGGTCTAAAGCGGACACC
AATGGGATTGCTTNTAGAGGCACTGGGACAGGAGCAGGAAGCTGGATCCTAGGACCTTGGCATCTACACCCTGGACGTAG
AGGACCCCCACCCCATACCCAAGACCAACCCTTTTCCTAGCCATTAAAATAGGTGCCTAGAGTCCTCTGGCCTGGCCAAA
AAGAGACACCTGTGATTGATCACTGCAGCCCCAAACTAGTCATCTCTTAGCCTCCAGCCCCTGTTACCTAGGGACCAAAG
TCTTCCTCGGTCCTGAATTTGAGACTCAGTCACCTACTTCCAGTCTTGAAACTGGACTTTTAAGCCAGAGCATCTGTGGC
CAATCTCAAAACTGGACCCCAAGATACTCCTCTGACCCAAATGTGGGACTCACTAGTCTTCCATACGTCAAAGCTAGGCC
CTAAGGCAGGAC
Sequence Type mRNA
Unitrap ID UNI17677

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7307402..7307893 488
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031149 (Praf2) NM_138602 PRA1 domain family 2 Gene [Source:MGI (curated);Acc:Praf2-001]

 
Come back to gene ENSMUSG00000031149


For any suggestions or comments, please send an email to unitrap@crg.es