Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST15930
Clone ID OST15930
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST15930
Sequence
GCTCCAGAAACATGACAGAGAAGAAGAGGACTCGCCAGCCTTTTGGAGATCTGAGGAGGANATGGCTGCATAGGCGGAGG
CTCTGCGGGTCTACTTTCAGGCCTGANAGTAACTCANACGATTCCCAAGGCATAAGAAAATGGACCCCATTCTTCTGGAG
TCTTCGACATTGGAAATGAAGCTAACCACTCTTTATTGTACCCCACGACCCCACAGCCTTGTACAAAGAACTTTATTGCA
TGTGTGGAAGCCACTAGTATTATGCTTCCATCACGATGACAAATAGGCTAGCTTCCCAAACAGTGGCATTGACAGCCTGC
CACCGTTCCTCAGTTCTGTACTTAGAATAGTAACATTTCCAAACTGTCCCTGAGCCTAGATGAAAATAAAGTGGTTGCTA
AAATATTA
Sequence Type mRNA
Unitrap ID UNI13884

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 10382606..10406026 307
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060579 (Fhit) NP_034340 fragile histidine triad gene Gene [Source:MGI Symbol;Acc:MGI:1277947]

 
Come back to gene ENSMUSG00000060579


For any suggestions or comments, please send an email to unitrap@crg.es