Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST15920
Clone ID OST15920
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST15920
Sequence
TGTATAGCTGACACTCTGNATAACACNTGGTAGCTATCTGCTGGAGAAGTCGCGAGTGATCTTCCAGCTGCCCGGTGAGC
GTGGTTACCATGTCTACTACCAGATCCTCTCAGGGAAGAAGCCGGAGCTGCAGGGTGAGGGTCAGGATGGGAGGTCAGAT
CCCAAAGACACTGCCTGGCTCTGGGATGGGTGTTCACCCTCTCTGCAGAGGCGTGGGGCACCTCCACTCTCCTGGNAACA
CACAGCTGTTTGTCCCACCCTTTTTCTTCCTACTGC
Sequence Type mRNA
Unitrap ID UNI28925

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155444470..155444711 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074652 (Myh7b) NP_001078847 myosin, heavy chain 7B, cardiac muscle, beta Gene [Source:MGI (curated);Acc:Myh7b-001]

 
Come back to gene ENSMUSG00000074652


For any suggestions or comments, please send an email to unitrap@crg.es