Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG905
Clone ID XG905
Vector pGT1Lxf
Project baygenomics

Sequence tag XG905
Sequence
ATGCTGGCAGTGGAGGGGGGCCCTCTCCAGTGGCTGCAGAGGGGCCCTCAAGTGCTACTGCATCGATCCTCTCTGGCTTC
GGAGGCATCCTGGGACTGGGCAGCCTGGGCCTGGGCTCCGCCAACTTTATGGAGCTGCAGCAACAGATGCAGAGACAGCT
CATGTCCAATCCTGAGATGCTGTCGCAGATCATGGAGAACCCCTTGGTCCAGGATATGATGTCAAACCCTGATCTGATGC
GCCACATGATCATGGCTAATCCCCAGATGCAGCAGCTGATGGAGAGGAACCCCGAGATCAGCCACATGCTCAACAACCCA
GAGCTCATGAGGCAGACAATGGAGCTTGCTCGTAACCCAGCCATGATGCAAGAAATGATGCGGAACCAGGACCGGGCCCT
CAGCAACCTGGAAAGTGTCCCGGGAGGGTATAATGCCATCCGCCGCATGTACACGGACATCCAGGAGCCCATGTTCATTG
CTGCTCGGGAA
Sequence Type mRNA
Unitrap ID UNI9685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88359843..88363695 263
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008604 (Ubqln4) NM_033526 ubiquilin 4 Gene [Source:MGI Symbol;Acc:MGI:2150152]

 
Come back to gene ENSMUSG00000008604


For any suggestions or comments, please send an email to unitrap@crg.es